DNA Codon Translator

Enter a DNA sequence to see its RNA codons, amino acid translation, and GC content.

Worked example — DNA Codon Translator

GC content	33.3%
Codons	6
Sequence length	18 bp
Unique amino acids	5 of 20

These are the values the calculator shows when the page opens. Change any input above to recompute them.

Loading interactive simulation...

Sixty-four codons for twenty amino acids 🖖

Sixty-four codons, twenty amino acids and three stop signals: the code has to repeat itself, and it repeats in a particular place. Amino acids that share codons almost always differ only in the third base, which is the position a tRNA anticodon reads most loosely — Crick's wobble. So a large share of single-base substitutions in that third position change the DNA and leave the protein alone. Click Silent Mutation, then Start Codon: one base apart, the same five amino acids. How good is that arrangement? Freeland and Hurst generated a million alternative codes and found just one that buffered errors better than the real one, on their measure of what a mistake costs.

Reading life three letters at a time 🖖

A cell reads DNA in non-overlapping groups of three bases called codons. Translation begins at the start codon ATG (which also codes for methionine) and runs codon by codon until it hits a stop signal — TAA, TAG, or TGA. This tool splits your sequence into those triplets and shows the amino acid each one specifies. Where you begin reading matters — shift the start by a single base and every codon downstream changes, producing an entirely different protein.

The 'universal' code has dialects 🖖

The genetic code is nearly universal, but not perfectly. Your own mitochondria read it differently from the rest of your cells: TGA, normally a stop signal, is read as tryptophan, ATA becomes methionine instead of isoleucine, and AGA/AGG flip from arginine to stop. Some single-celled ciliates even reassign stop codons to glutamine. So the same triplet can mean different things depending on which genome is doing the reading.

What a real sequence looks like

Five sequences worth knowing — and one that is not a gene

The box above opens on eighteen bases that somebody invented. These five are real: four reading frames taken from the sequence databases and one famous stretch of DNA that is not one. Click any of them to load it into the tool.

Sequence	Bases	Length	GC	Translates to
Human β-globin, first eight codons	`ATGGTGCATCTGACTCCTGAGGAG`	24 bp	54.2%	Met-Val-His-Leu-Thr-Pro-Glu-Glu
The same, with the sickle-cell change	`ATGGTGCATCTGACTCCTGTGGAG`	24 bp	54.2%	Met-Val-His-Leu-Thr-Pro-Val-Glu
Green fluorescent protein, start	`ATGAGTAAAGGAGAAGAACTTTTCACTGGA`	30 bp	36.7%	Met-Ser-Lys-Gly-Glu-Glu-Leu-Phe-Thr-Gly
Preproinsulin signal peptide, start	`ATGGCCCTGTGGATGCGCCTCCTGCCCCTGCTG`	33 bp	69.7%	Met-Ala-Leu-Trp-Met-Arg-Leu-Leu-Pro-Leu-Leu
The Kozak context — not a reading frame	`GCCACCATGG`	10 bp	70.0%	Ala-Thr-Met

Read the first two rows together and nothing else on this page matters as much. They differ at one base out of twenty-four — the twentieth — and the translation column turns that into Glu becoming Val at the seventh position. That single substitution is sickle-cell disease. Everything else here is scale and variety: GC runs from 36.7% in a jellyfish protein to 69.7% in the signal peptide of human insulin, so a sequence being GC-rich says more about which organism and which part of the gene than about what it does. And the last row is a warning about this tool rather than an example for it. The Kozak context is the signal that marks where translation should START; it is not itself a reading frame, and the tool cheerfully translates it to Ala-Thr-Met anyway. A calculator cannot tell you whether your question makes sense.

Problem solved in full

A three-letter codon for eighteen bases and 33.3% GC 5 steps
Eighteen bases, six codons, 33.3% GC. Work out why a three-letter codon is the shortest one that could possibly work, and what the leftover capacity buys.
1. The sequence divides into codons of three, so eighteen bases give six — and the last is TAA, a stop, which is why this reads as a complete short gene.
  
  $ATGAAACGTTTTGCCTAA : 18 bases = 6 codons$
2. GC content counts the G and C bases, six of eighteen. It matters because G–C pairs have three hydrogen bonds to A–T's two, so a GC-rich sequence melts at a higher temperature.
  
  $G,C count = 6 ⟹ \frac{6}{18} = 33.3%$
3. Now the size question. Four bases taken two at a time give 16 combinations — fewer than the 20 amino acids that must be encoded, so pairs cannot work.
4. Three at a time gives 64, against 21 things to name counting the stop signal. Three is therefore the shortest workable word length, and it was deduced before it was observed.
  
  $4^{3} = 64 codons ⟶ 20 amino acids + stop = 21$
5. That leaves 64 mapping onto 21, roughly three codons per meaning. The surplus is spent on redundancy, not on ambiguity: several codons name the same amino acid, but none names two.
  
  $\frac{64}{21} = 3.05 ⟹ the code is redundant, not ambiguous$
Answer

The tool prints 18 bp, 6 codons and 33.3% GC. The redundancy is the part with consequences. Because synonyms usually differ in the third base, a mutation there often changes nothing at all — the code has a built-in error tolerance that is a property of the mapping, not of any repair machinery. The reading frame has the opposite property: delete one base and every codon after it is regrouped, turning the rest of the gene into nonsense. Same three-letter structure, and it makes one kind of error nearly free and the other catastrophic.

$64 \to 21 is many-to-one; a 1-base shift reframes every codon after it$

References (6)

The code the tool tabulates: F. H. C. Crick, L. Barnett, S. Brenner and R. J. Watts-Tobin, "General Nature of the Genetic Code for Proteins." Nature 192, 1227–1232, 1961.
The error-minimising structure, and how strong that claim actually is: S. J. Freeland and L. D. Hurst, "The Genetic Code Is One in a Million." Journal of Molecular Evolution 47(3), 238–248, 1998.
The sequence library below: where its bases were fetched from, accession by accession: NCBI Reference Sequence Database — HBB (NM_000518.5) and INS (NM_000207) coding sequences, and GFP (GenBank M62653.1). Retrieved 2026-08-06.
And the result the first two rows of that table exist to show: V. M. Ingram, "Gene mutations in human haemoglobin: the chemical difference between normal and sickle cell haemoglobin." Nature 180, 326–328, 1957 — one amino acid.
The jellyfish protein that made cell biology visible: D. C. Prasher, V. K. Eckenrode, W. W. Ward, F. G. Prendergast & M. J. Cormier, "Primary structure of the Aequorea victoria green-fluorescent protein." Gene 111(2), 229–233, 1992.
And the context that tells a ribosome where to start, which is the last row and not a gene: M. Kozak, "An analysis of 5′-noncoding sequences from 699 vertebrate messenger RNAs." Nucleic Acids Research 15(20), 8125–8148, 1987.

By the 42Math team · Updated 2026-07-14

Reviewed against published sources. Corrections welcome. Editorial policy · Corrections

All Bio, Geo, Chem lessons →

Example problems

Start Codon - ATG AAA CGT TTT GCC TAA: six codons reading Met-Lys-Arg-Phe-Ala-Stop, at 33.3% GC. This is the worked problem's sequence.
GC-Rich - 14 of 16 bases are G or C, so 87.5% GC and a high melting temperature. Sixteen is not a multiple of three, so the last base has no codon to belong to.
Open Reading Frame - 54 bases, 18 codons, ending on TAA. The ATG at codon 13 is an internal methionine, not a second start - a reading frame has only one beginning.
Silent Mutation - One base different from Start Codon - CGT became CGC - and both still read Arg, so the protein is unchanged. Only the GC content moves, from 33.3% to 38.9%.